Review



negative control grna transduced id8 gc  (Zymo Research)


Bioz Verified Symbol Zymo Research is a verified supplier
Bioz Manufacturer Symbol Zymo Research manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Zymo Research negative control grna transduced id8 gc
    Negative Control Grna Transduced Id8 Gc, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 196 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control grna transduced id8 gc/product/Zymo Research
    Average 95 stars, based on 196 article reviews
    negative control grna transduced id8 gc - by Bioz Stars, 2026-06
    95/100 stars

    Images



    Similar Products

    95
    Zymo Research negative control grna transduced id8 gc
    Negative Control Grna Transduced Id8 Gc, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control grna transduced id8 gc/product/Zymo Research
    Average 95 stars, based on 1 article reviews
    negative control grna transduced id8 gc - by Bioz Stars, 2026-06
    95/100 stars
      Buy from Supplier

    95
    Zymo Research negative control grna
    Negative Control Grna, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control grna/product/Zymo Research
    Average 95 stars, based on 1 article reviews
    negative control grna - by Bioz Stars, 2026-06
    95/100 stars
      Buy from Supplier

    86
    Synthego Inc negative control scrambled synthetic guide rna
    Genetic depletion of SOX11 reduced the expression of PAX5 and CD19. (A) CRISPR/Cas9- and short hairpin <t>RNA</t> (shRNA)-mediated knockdown of SOX11 resulted in reduced protein levels of PAX5 and CD19 in JeKo-1 and Z-138 cells. SCR refers to the scramble control; sg_SOX11 indicates <t>guide</t> <t>RNAs</t> C1 and C2; sh_SOX11 represents shRNA constructs C1 and C2, respectively. (B) Genetic knockdown of SOX11 led to reduced phosphorylation of downstream BCR signaling components. SOX11-deficient cells were stimulated with 5 μg/mL of IgM for 10 minutes, followed by immunoblot analysis of whole-cell lysates. (C) Overexpression of SOX11, tagged with 3XFlag, induces elevated levels of PAX5 and CD19 expression in the MAVER-1 and JeKo-1 cell lines. (D) Ectopic expression of SOX11 resulted in an increased level of PAX5 and CD19 in the SOX11-negative cell line JVM-2. Immunoblot experiments were performed to validate the results, and β-actin was used as a loading control to ensure equivalent loading and transfer. SCR, scramble control; sg_SOX11, guide RNAs C1 and C2; sh_SOX11, shRNA constructs C1 and C2.
    Negative Control Scrambled Synthetic Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control scrambled synthetic guide rna/product/Synthego Inc
    Average 86 stars, based on 1 article reviews
    negative control scrambled synthetic guide rna - by Bioz Stars, 2026-06
    86/100 stars
      Buy from Supplier

    90
    Thermo Fisher nontargeting grna lentiarray crispr negative control lentivirus
    (A) <t>CRISPR/Cas9</t> screening approach used for the identification of epigenetic regulator genes (ERGs) involved in the acquisition of mesenchymal breast cancer stem cell (BCSC) markers in non-tumorigenic breast cells. Adapted from Halaburkova et al. 2020 . <t>gRNA:</t> guide RNA. (B) Representation of enriched ERG gRNAs (false discovery rate [FDR] < 0.05) identified in the mesenchymal BCSC-like population of MCF10A cells infected with the ERG gRNA library compared to the bulk of cells on the day of sorting (n=2 MCF10A-Cas9 expressing clones). (C) Venn diagram of ERGs showing single nucleotide alterations in BC patients (TCGA-BRCA) of different molecular subtypes. Top 7 mutated ERGs identified in the TNBC subtype (proportion of SNAs (pSNA) > 0.019) are highlighted. (D) Kaplan-Meier analysis of disease-free survival in BC patients (TCGA-BRCA) divided in high and low BAP1 gene expression groups. * P < 0.05, ** P < 0.01.
    Nontargeting Grna Lentiarray Crispr Negative Control Lentivirus, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nontargeting grna lentiarray crispr negative control lentivirus/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    nontargeting grna lentiarray crispr negative control lentivirus - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Synthego Inc guide rnas (grna) against lman2l or a non-targeting negative control
    US2 degrades <t>LMAN2L</t> via the proteasome. (a) Venn diagram showing the overlap between shortlists of proteins: (i) degraded early during HCMV infection ; (ii) significantly rescued upon infection with an HCMV gene-block deletion mutant compared to wild-type infection [55]; and (iii) assigned the gene ontology term ‘protein transport’ (GO:0015031) according to the AmiGO database [ , ]. The following two panels (b, c) are based on data from our prior publication [55], and are the only previously published data in this paper. (b) Three orthogonal protein degradation screens showing that LMAN2L is degraded with medium confidence during early HCMV infection (from [55]). Left panel: LMAN2L was rescued from degradation by the proteasome inhibitor MG132 in HCMV-infected cells, but not during mock infection, infection with UV-irradiated HCMV (HCMV*) or inhibition with the lysosomal protease inhibitor leupeptin (see also figure 1 from [55]). Middle panel: increased rate of LMAN2L degradation from 4 h of HCMV compared to mock infection. Cells were pre-labelled with medium SILAC amino acids prior to infection, then switched to heavy amino acids at the point of infection. Quantification of medium-labelled proteins over time using tandem mass tag (TMT)-based multiplexing facilitated quantification of protein degradation rates (see also figure 2 from [55]). Right panel: relative abundance of LMAN2L protein and transcript over 72 h of infection. (c) A proteomic screen of HCMV block deletion mutants determined that the US1–US11 gene block is required to downregulate LMAN2L [55]. Abundance is shown relative to WT HCMV. A value of 1 indicates no change. (d) Immunoblot showing expression of endogenous LMAN2L in HFFF-CAR infected with RAd expressing V5-tagged US1–US11 genes (m.o.i. 10, 72 h). LMAN2L abundance was normalized to GAPDH and is shown relative to the control RAd given a value of 1. Error bars represent the range ( n =2). Validation of transgene expression is shown in Fig. S1. (e) Immunoblot of lysates from HFFF-TERTs infected with strain Merlin HCMV, and ΔUS2, ΔUS3 or ΔUS11 recombinants (m.o.i. 5, 24 h), or mock infected. Immunoblot shown is representative of two independent experiments.
    Guide Rnas (Grna) Against Lman2l Or A Non Targeting Negative Control, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/guide rnas (grna) against lman2l or a non-targeting negative control/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    guide rnas (grna) against lman2l or a non-targeting negative control - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Millipore negative control non-targeting grna (5'-cgcgatagcgcgaatatatt-3

    Negative Control Non Targeting Grna (5' Cgcgatagcgcgaatatatt 3, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control non-targeting grna (5'-cgcgatagcgcgaatatatt-3/product/Millipore
    Average 90 stars, based on 1 article reviews
    negative control non-targeting grna (5'-cgcgatagcgcgaatatatt-3 - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    86
    Danaher Inc negative control grna

    Negative Control Grna, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control grna/product/Danaher Inc
    Average 86 stars, based on 1 article reviews
    negative control grna - by Bioz Stars, 2026-06
    86/100 stars
      Buy from Supplier

    96
    Addgene inc grna negative control constructs grna cloning vector

    Grna Negative Control Constructs Grna Cloning Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/grna negative control constructs grna cloning vector/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    grna negative control constructs grna cloning vector - by Bioz Stars, 2026-06
    96/100 stars
      Buy from Supplier

    Image Search Results


    Genetic depletion of SOX11 reduced the expression of PAX5 and CD19. (A) CRISPR/Cas9- and short hairpin RNA (shRNA)-mediated knockdown of SOX11 resulted in reduced protein levels of PAX5 and CD19 in JeKo-1 and Z-138 cells. SCR refers to the scramble control; sg_SOX11 indicates guide RNAs C1 and C2; sh_SOX11 represents shRNA constructs C1 and C2, respectively. (B) Genetic knockdown of SOX11 led to reduced phosphorylation of downstream BCR signaling components. SOX11-deficient cells were stimulated with 5 μg/mL of IgM for 10 minutes, followed by immunoblot analysis of whole-cell lysates. (C) Overexpression of SOX11, tagged with 3XFlag, induces elevated levels of PAX5 and CD19 expression in the MAVER-1 and JeKo-1 cell lines. (D) Ectopic expression of SOX11 resulted in an increased level of PAX5 and CD19 in the SOX11-negative cell line JVM-2. Immunoblot experiments were performed to validate the results, and β-actin was used as a loading control to ensure equivalent loading and transfer. SCR, scramble control; sg_SOX11, guide RNAs C1 and C2; sh_SOX11, shRNA constructs C1 and C2.

    Journal: Blood Advances

    Article Title: SOX11 modulates BCR signaling through the PAX5/CD19 axis for therapeutic targeting in BTK-resistant mantle cell lymphoma

    doi: 10.1182/bloodadvances.2025016801

    Figure Lengend Snippet: Genetic depletion of SOX11 reduced the expression of PAX5 and CD19. (A) CRISPR/Cas9- and short hairpin RNA (shRNA)-mediated knockdown of SOX11 resulted in reduced protein levels of PAX5 and CD19 in JeKo-1 and Z-138 cells. SCR refers to the scramble control; sg_SOX11 indicates guide RNAs C1 and C2; sh_SOX11 represents shRNA constructs C1 and C2, respectively. (B) Genetic knockdown of SOX11 led to reduced phosphorylation of downstream BCR signaling components. SOX11-deficient cells were stimulated with 5 μg/mL of IgM for 10 minutes, followed by immunoblot analysis of whole-cell lysates. (C) Overexpression of SOX11, tagged with 3XFlag, induces elevated levels of PAX5 and CD19 expression in the MAVER-1 and JeKo-1 cell lines. (D) Ectopic expression of SOX11 resulted in an increased level of PAX5 and CD19 in the SOX11-negative cell line JVM-2. Immunoblot experiments were performed to validate the results, and β-actin was used as a loading control to ensure equivalent loading and transfer. SCR, scramble control; sg_SOX11, guide RNAs C1 and C2; sh_SOX11, shRNA constructs C1 and C2.

    Article Snippet: CRISPRevolution synthetic guide RNAs targeting SOX11 (sequence: CCGGGAGGCGCUGGACACGG) and negative control scrambled synthetic guide RNA were procured from Synthego.

    Techniques: Expressing, CRISPR, shRNA, Knockdown, Control, Construct, Phospho-proteomics, Western Blot, Over Expression

    (A) CRISPR/Cas9 screening approach used for the identification of epigenetic regulator genes (ERGs) involved in the acquisition of mesenchymal breast cancer stem cell (BCSC) markers in non-tumorigenic breast cells. Adapted from Halaburkova et al. 2020 . gRNA: guide RNA. (B) Representation of enriched ERG gRNAs (false discovery rate [FDR] < 0.05) identified in the mesenchymal BCSC-like population of MCF10A cells infected with the ERG gRNA library compared to the bulk of cells on the day of sorting (n=2 MCF10A-Cas9 expressing clones). (C) Venn diagram of ERGs showing single nucleotide alterations in BC patients (TCGA-BRCA) of different molecular subtypes. Top 7 mutated ERGs identified in the TNBC subtype (proportion of SNAs (pSNA) > 0.019) are highlighted. (D) Kaplan-Meier analysis of disease-free survival in BC patients (TCGA-BRCA) divided in high and low BAP1 gene expression groups. * P < 0.05, ** P < 0.01.

    Journal: bioRxiv

    Article Title: Disruption of the epigenetic regulator BAP1 drives chromatin remodeling leading to the emergence of cells with breast cancer stem cell properties and aberrant glycosylation

    doi: 10.1101/2024.12.12.628129

    Figure Lengend Snippet: (A) CRISPR/Cas9 screening approach used for the identification of epigenetic regulator genes (ERGs) involved in the acquisition of mesenchymal breast cancer stem cell (BCSC) markers in non-tumorigenic breast cells. Adapted from Halaburkova et al. 2020 . gRNA: guide RNA. (B) Representation of enriched ERG gRNAs (false discovery rate [FDR] < 0.05) identified in the mesenchymal BCSC-like population of MCF10A cells infected with the ERG gRNA library compared to the bulk of cells on the day of sorting (n=2 MCF10A-Cas9 expressing clones). (C) Venn diagram of ERGs showing single nucleotide alterations in BC patients (TCGA-BRCA) of different molecular subtypes. Top 7 mutated ERGs identified in the TNBC subtype (proportion of SNAs (pSNA) > 0.019) are highlighted. (D) Kaplan-Meier analysis of disease-free survival in BC patients (TCGA-BRCA) divided in high and low BAP1 gene expression groups. * P < 0.05, ** P < 0.01.

    Article Snippet: Nontargeting gRNA LentiArray CRISPR Negative Control Lentivirus (Thermo Fisher Scientific) was used as a negative control.

    Techniques: CRISPR, Infection, Expressing, Clone Assay

    US2 degrades LMAN2L via the proteasome. (a) Venn diagram showing the overlap between shortlists of proteins: (i) degraded early during HCMV infection ; (ii) significantly rescued upon infection with an HCMV gene-block deletion mutant compared to wild-type infection [55]; and (iii) assigned the gene ontology term ‘protein transport’ (GO:0015031) according to the AmiGO database [ , ]. The following two panels (b, c) are based on data from our prior publication [55], and are the only previously published data in this paper. (b) Three orthogonal protein degradation screens showing that LMAN2L is degraded with medium confidence during early HCMV infection (from [55]). Left panel: LMAN2L was rescued from degradation by the proteasome inhibitor MG132 in HCMV-infected cells, but not during mock infection, infection with UV-irradiated HCMV (HCMV*) or inhibition with the lysosomal protease inhibitor leupeptin (see also figure 1 from [55]). Middle panel: increased rate of LMAN2L degradation from 4 h of HCMV compared to mock infection. Cells were pre-labelled with medium SILAC amino acids prior to infection, then switched to heavy amino acids at the point of infection. Quantification of medium-labelled proteins over time using tandem mass tag (TMT)-based multiplexing facilitated quantification of protein degradation rates (see also figure 2 from [55]). Right panel: relative abundance of LMAN2L protein and transcript over 72 h of infection. (c) A proteomic screen of HCMV block deletion mutants determined that the US1–US11 gene block is required to downregulate LMAN2L [55]. Abundance is shown relative to WT HCMV. A value of 1 indicates no change. (d) Immunoblot showing expression of endogenous LMAN2L in HFFF-CAR infected with RAd expressing V5-tagged US1–US11 genes (m.o.i. 10, 72 h). LMAN2L abundance was normalized to GAPDH and is shown relative to the control RAd given a value of 1. Error bars represent the range ( n =2). Validation of transgene expression is shown in Fig. S1. (e) Immunoblot of lysates from HFFF-TERTs infected with strain Merlin HCMV, and ΔUS2, ΔUS3 or ΔUS11 recombinants (m.o.i. 5, 24 h), or mock infected. Immunoblot shown is representative of two independent experiments.

    Journal: The Journal of General Virology

    Article Title: HCMV US2 co-opts TRC8 to degrade the endoplasmic reticulum-resident protein LMAN2L

    doi: 10.1099/jgv.0.001980

    Figure Lengend Snippet: US2 degrades LMAN2L via the proteasome. (a) Venn diagram showing the overlap between shortlists of proteins: (i) degraded early during HCMV infection ; (ii) significantly rescued upon infection with an HCMV gene-block deletion mutant compared to wild-type infection [55]; and (iii) assigned the gene ontology term ‘protein transport’ (GO:0015031) according to the AmiGO database [ , ]. The following two panels (b, c) are based on data from our prior publication [55], and are the only previously published data in this paper. (b) Three orthogonal protein degradation screens showing that LMAN2L is degraded with medium confidence during early HCMV infection (from [55]). Left panel: LMAN2L was rescued from degradation by the proteasome inhibitor MG132 in HCMV-infected cells, but not during mock infection, infection with UV-irradiated HCMV (HCMV*) or inhibition with the lysosomal protease inhibitor leupeptin (see also figure 1 from [55]). Middle panel: increased rate of LMAN2L degradation from 4 h of HCMV compared to mock infection. Cells were pre-labelled with medium SILAC amino acids prior to infection, then switched to heavy amino acids at the point of infection. Quantification of medium-labelled proteins over time using tandem mass tag (TMT)-based multiplexing facilitated quantification of protein degradation rates (see also figure 2 from [55]). Right panel: relative abundance of LMAN2L protein and transcript over 72 h of infection. (c) A proteomic screen of HCMV block deletion mutants determined that the US1–US11 gene block is required to downregulate LMAN2L [55]. Abundance is shown relative to WT HCMV. A value of 1 indicates no change. (d) Immunoblot showing expression of endogenous LMAN2L in HFFF-CAR infected with RAd expressing V5-tagged US1–US11 genes (m.o.i. 10, 72 h). LMAN2L abundance was normalized to GAPDH and is shown relative to the control RAd given a value of 1. Error bars represent the range ( n =2). Validation of transgene expression is shown in Fig. S1. (e) Immunoblot of lysates from HFFF-TERTs infected with strain Merlin HCMV, and ΔUS2, ΔUS3 or ΔUS11 recombinants (m.o.i. 5, 24 h), or mock infected. Immunoblot shown is representative of two independent experiments.

    Article Snippet: Low passage HFFF-TERTs were nucleofected with ribonucleoprotein (RNP) complexes containing recombinant Cas9 nuclease (IDT, 1081059) and guide RNAs (gRNA) against LMAN2L or a non-targeting negative control (Synthego), using the Nucleofector 2d Transfection Device (Lonza).

    Techniques: Infection, Blocking Assay, Mutagenesis, Irradiation, Inhibition, Protease Inhibitor, Multiplex sample analysis, Multiplexing, Western Blot, Expressing, Control, Biomarker Discovery

    Cellular E3 ligase TRC8 is necessary for LMAN2L degradation. ( a ) Schematic of the mechanism of US2 and TRC8-mediated degradation of membrane proteins, adapted from Hsu et al . . ( b ) Confirmation of TRC8 knockdown. HFFF-TERTs were transduced with TRC8 or scrambled control shRNA plasmids and knockdown efficiency was quantified by RT-qPCR. Relative RNA levels were calculated using the 2 −ΔΔCT method . ( c ) LMAN2L expression in HCMV-infected TRC8 shRNA knockdown cells. Control (-) and TRC8 shRNA (+) cell lines were infected with strain Merlin WT HCMV or a ΔUS2 strain Merlin recombinant for 24 h (m.o.i. 5), and LMAN2L expression was measured by immunoblot. The LMAN2L signal was normalized to GAPDH and is shown relative to mock control samples. The average relative abundance is shown across three biological replicates and error bars represent the standard error of the mean, except for samples infected with ΔUS2 where there were no biological replicates. P -values were calculated using a two-sample unpaired t-test. * P <0.05.

    Journal: The Journal of General Virology

    Article Title: HCMV US2 co-opts TRC8 to degrade the endoplasmic reticulum-resident protein LMAN2L

    doi: 10.1099/jgv.0.001980

    Figure Lengend Snippet: Cellular E3 ligase TRC8 is necessary for LMAN2L degradation. ( a ) Schematic of the mechanism of US2 and TRC8-mediated degradation of membrane proteins, adapted from Hsu et al . . ( b ) Confirmation of TRC8 knockdown. HFFF-TERTs were transduced with TRC8 or scrambled control shRNA plasmids and knockdown efficiency was quantified by RT-qPCR. Relative RNA levels were calculated using the 2 −ΔΔCT method . ( c ) LMAN2L expression in HCMV-infected TRC8 shRNA knockdown cells. Control (-) and TRC8 shRNA (+) cell lines were infected with strain Merlin WT HCMV or a ΔUS2 strain Merlin recombinant for 24 h (m.o.i. 5), and LMAN2L expression was measured by immunoblot. The LMAN2L signal was normalized to GAPDH and is shown relative to mock control samples. The average relative abundance is shown across three biological replicates and error bars represent the standard error of the mean, except for samples infected with ΔUS2 where there were no biological replicates. P -values were calculated using a two-sample unpaired t-test. * P <0.05.

    Article Snippet: Low passage HFFF-TERTs were nucleofected with ribonucleoprotein (RNP) complexes containing recombinant Cas9 nuclease (IDT, 1081059) and guide RNAs (gRNA) against LMAN2L or a non-targeting negative control (Synthego), using the Nucleofector 2d Transfection Device (Lonza).

    Techniques: Membrane, Knockdown, Transduction, Control, shRNA, Quantitative RT-PCR, Expressing, Infection, Recombinant, Western Blot

    LMAN2L-dependent expression of proteins at the plasma membrane. ( a ) Schematic of the PMP workflow. ( b ) Immunoblot validation of LMAN2L knockdown/knockout in bulk CRISPR KO cells (top) and after siRNA treatment (bottom). Percentage decrease was calculated relative to the corresponding negative controls (ctrl). ( c ) Scatterplot comparing the average fold change from siRNA ( n =3) and CRISPR samples ( n =1). A coefficient of variation (CV) was calculated by dividing the standard deviation by the average fold change across siRNA and bulk CRISPR samples and multiplying by 100. Entries with a CV>30 were excluded from further analysis. Significance A was used to calculate P -values, which were corrected for multiple testing using the Benjamini–Hochberg method [ ]. Proteins that were significantly downregulated ( P <0.05) in both LMAN2L siRNA and LMAN2L bulk KO are labelled and highlighted in orange. ( d ) Fold change of proteins significantly downregulated in both LMAN2L siRNA knockdown and bulk LMAN2L KO cells compared to the corresponding control. Error bars represent the standard error of the mean. ( e ) Fold change of all integrin molecules quantified in the proteomic screen. The bottom and top of the box show the first and third quartile, respectively, and the median is shown as the line inside the box. Individual fold changes for the replicates are shown as data points.

    Journal: The Journal of General Virology

    Article Title: HCMV US2 co-opts TRC8 to degrade the endoplasmic reticulum-resident protein LMAN2L

    doi: 10.1099/jgv.0.001980

    Figure Lengend Snippet: LMAN2L-dependent expression of proteins at the plasma membrane. ( a ) Schematic of the PMP workflow. ( b ) Immunoblot validation of LMAN2L knockdown/knockout in bulk CRISPR KO cells (top) and after siRNA treatment (bottom). Percentage decrease was calculated relative to the corresponding negative controls (ctrl). ( c ) Scatterplot comparing the average fold change from siRNA ( n =3) and CRISPR samples ( n =1). A coefficient of variation (CV) was calculated by dividing the standard deviation by the average fold change across siRNA and bulk CRISPR samples and multiplying by 100. Entries with a CV>30 were excluded from further analysis. Significance A was used to calculate P -values, which were corrected for multiple testing using the Benjamini–Hochberg method [ ]. Proteins that were significantly downregulated ( P <0.05) in both LMAN2L siRNA and LMAN2L bulk KO are labelled and highlighted in orange. ( d ) Fold change of proteins significantly downregulated in both LMAN2L siRNA knockdown and bulk LMAN2L KO cells compared to the corresponding control. Error bars represent the standard error of the mean. ( e ) Fold change of all integrin molecules quantified in the proteomic screen. The bottom and top of the box show the first and third quartile, respectively, and the median is shown as the line inside the box. Individual fold changes for the replicates are shown as data points.

    Article Snippet: Low passage HFFF-TERTs were nucleofected with ribonucleoprotein (RNP) complexes containing recombinant Cas9 nuclease (IDT, 1081059) and guide RNAs (gRNA) against LMAN2L or a non-targeting negative control (Synthego), using the Nucleofector 2d Transfection Device (Lonza).

    Techniques: Expressing, Clinical Proteomics, Membrane, Western Blot, Biomarker Discovery, Knockdown, Knock-Out, CRISPR, Standard Deviation, Control

    Journal: Cell Reports Medicine

    Article Title: Identification and targeting of protein tyrosine kinase 7 (PTK7) as an immunotherapy candidate for neuroblastoma

    doi: 10.1016/j.xcrm.2023.101091

    Figure Lengend Snippet:

    Article Snippet: Negative Control non-targeting gRNA (5′-CGCGATAGCGCGAATATATT-3′) , Sigma , .

    Techniques: Microarray, Recombinant, Cell Isolation, Mass Spectrometry, CRISPR, Negative Control, Software, Lysis, Protease Inhibitor, Bradford Protein Assay, BIA-KA, Binding Assay